Write an application to a university applying for a course

Answers

Answer 1

Answer:

This letter is a formal request for admission to [name of college. Over the past few years, I've researched many colleges that offer [type of degree]'s in [field of study], but have ultimately chosen [name of college] because of its commitment to [school's or program's goals, objective or mission]. Unlike other colleges, your program differs from other college's offering a similar programs

Currently, I'm looking to begin my undergraduate studies. My goal is to complete 4 years at [college Name ] . Upon graduation, I hope to gain employment as a [job title] where I can [career goals]. I believe [name of college] gives me the best option in preparing for my future endeavors thanks to its [the program or college's unique offerings].

My application form and the requested documents are enclosed. I'm available for additional questions and look forward to hearing from you soon. Thank you for your time and consideration regarding my application.

Sincerely,

[Your first name] [your last name]

Explanation:


Related Questions

give an example of the word “inherent”

Answers

Answer:

fly

Explanation:

the word inherent means fly so the word that is like the same as inherent is fly

How did teddy react to his teacher even in his collage life

Answers

Answer:

In his note, he mentioned that she was still the best teacher he ever had in his life.

Teddy gave his teacher a rhinestone bracelet and perfume as a Christmas gift.

I do not know but I need to answer

What is the most likely reason the national park service chose the three goals mentioned in paragraph 5 for the project?

Answers

Answer:

D

Explanation:

I just did it

The answer is D (bahabdidneicneidb)

In the last sentence of the passage, the author uses the parenthetical clause “though hope should always be deluded” primarily to
A. convince the audience that the pursuit of happiness is futile

B. assert that hope is important regardless of whether it comes to fruition

C. discourage the audience from indulging in unreasonable expectations

D. highlight the positive and negative aspects of hope

E. imply that the value of hope depends on its close connection with delusion

Answers

Answer:

B. assert that hope is important regardless of whether it comes to fruition

Explanation:

Answer B

Correct. In the last sentence of the passage, the author’s main claim is that it is “necessary to hope” because “hope itself is happiness.” He uses the parenthetical clause “though (even if) hope should always be deluded (frustrated)” to argue that even in the extreme case in which hopes never come to fruition, hope is nevertheless important—not only for its capacity to bring happiness, but because the disappointment that results from frustrated hope is “less dreadful than [hope’s] extinction.”

Answer:

B

Explanation:

assert that hope is important regardless of whether it comes to fruition

Read these central ideas from the article "Eileen Collins—NASA’s First Female Shuttle Commander to Lead Next Shuttle Mission." Collins is the first female Shuttle commander. Collins feels that completing a mission is the most exciting thing about spaceflight. How does the author develop these ideas? The author states that on her last mission, Collins became the first female Shuttle commander and includes a statement from Collins saying, "seeing the successful completion of the mission" is the most exciting part of spaceflight. The author begins the article by stating that Collins is the first female Shuttle commander and ends by explaining that Collins enjoys exploring space so much she wants to travel there as a tourist. The author explains that as an astronaut, Collins pursued operations research, which led to her becoming a Shuttle commander, and includes Collins's words that she used to think the launch was the most exciting. The author provides background information about Collins's career goal to become the first woman Shuttle commander and explains that Collins loves spaceflight.

Answers

Answer:

The author states that Collins joined the Air Force and became the first and only female Shuttle commander and that she would love to travel in space as a tourist

Explanation:

k12 test

Compare the text structure of Virginia’s Declaration of Rights with the text structure of the Declaration of Independence. What is similar about the texts? What is different?a

Answers

Answer:

need pic

Explanation:

Highlight the subject-verb error in the sentence below.

If Carly wants to keep training with me, then I insist that she practices the piano at least one hour a day, but I don’t think she will agree to do that.

Which subject-verb pairing corrects the error in the sentence?

Answers

Answer:

it is she

Explanation:

brainliest?

Answer:

she/practice

Explanation:

edge 2022

Malala discusses how the Taliban perceives women during her speech. This perception may appear very different from how women are viewed in America, but it could be argued that there are similarities between how some Americans and some Pakistanis view the roles of women. What claim would a person make to prove this point?

Can someone please help me

Answers

Answer:

I’m sorry but what do you mean?

Explanation:

Hello.
Can someone help me ?

You can just put the words that go on the line please. I thank.

Answers

Answer:

ourselves, themself, herself, them, yourself, myself, themself, himself, herself, itself, themself, yourself, himself, ourselves, themself, herself, yourself, myself, themself.

Explanation:

This is in 1-2-3 order, hope this helped!

in order for a substance to condense, you must______

a.take away coldness
b. add coldness
c. take away thermal energy
d. add thermal energy

Answers

Answer:

b. add coldness

Explanation:

The churros sheep provided good

Answers

Answer:

But what is this a question or just for fun?

Explanation:

Answer:

wool

Explanation:

please answer this question^_^​

Answers

Work on it yourself I dont understand ask your teacher and/or parent.

Write a dialogue between you and your friend about Bangabandhu Satelight

Answers

Jon: I need to do an essay on a Bengali element of great historical importance. I don't know what I can write about, do you have any suggestions?

Mary: Sure! You can write about Bangabandhu Satelight, I just read an article about it and I can help you.

Jon: It would be great. What do you know know about that?

Mary: Well, he was Bangladesh's first satellite and to be produced and sent into space. This was a very big milestone for Bengali technology, research and science.

Jon: Has it been released yet?

Mary: Yes, it is in orbit these days. It was launched in 2018 and will stay in orbit for about 15 years. The launch was also the result of Bengali research, as it brought together several scientists and engineers to allow a 3500 kg satellite to be launched and remain active.

Jon: Can you show me the article you read? I wanted to use it as a research source.

Mary: Sure. I'll send you right now.

why did the particle exselrater explode?

Answers

Answer:

In the first season we learn that Eobard Thawne - posing as Dr. Harrison Welles - deliberately caused the particle accelerator to go boom to "make" Barry the Flash. We also learned he changed history by doing so, as it would have gone off by accident in 2024 had he not changed anything

Explanation:

Which sentence uses a comma and a coordinating conjunction correctly to separate two independent clauses?
A. My brother is coming to the amusement park and, he said he'll ride the roller coaster
B. I've always enjoyed camping, but I don't get to go very often.
C. We'll have to keep the ball moving, play solid defense, and avoid costly penalties.
D. Without a doubt, that was the best party I've ever been to. SUBMIT PREVIOUS​

Answers

B the answer is B that is the correct answer

Pick the sentence that correctly uses grammar.

a. The first time a user places an order, they must provide a credit card number.
b. The first time a user places an order, we must provide a credit card number.
c. The first time a user places an order, he or she must provide a credit card number.
d. none of the above

Answers

Answer:

The answer is A

I hope this helps!

PLEASE HELP ASAP!!! WILL GIVE BRAINLY PLEASE HELp1! ITS FROM THE SECRET GARDEN

Answers

Answer:

Jan 10, 1900  Mary Comes to Yorkshire

Jan 10, 1900 Collector F.M. Davis of Chicago was Arrested

Jan 20, 1900 Mary finds out about the garden

Jan 20, 1900 John Ruskin died

Feb 4, 1900  Mary meets Colin

Feb 4, 1900 Fire in St. ...

Feb 7, 1900 Dickon brings Mary gardening tools

Feb 7, 1900 Thomas R

Explanation:

Who rushes to billys bedside after the plane crash

Answers

Answer:

Billy's mom?

Explanation:

Whats the context? Or is this a joke? Please give more info for example the passage maybe?

Please help me with 4 questions I'll give you 40 points

1. What's the relationship between the words civil and civilization? How are they similar? How are
they different?
I
2. According to the text, what is the most important factor of a civilization?

3. Do you think it is important to be civil in a civilization? Explain.

4. What are some of the ways we signal our feelings towards other people?

Answers

Answer: The term "civilization" is used in common parlance with both a normative and a descriptive dimension. In the past, to be "civilized", was linked to the feeling of being "civil," a term for politeness and propriety. To be "uncivilized" in this usage means to be "rude", "barbaric" or a "savage".

"plan your Life so you can live fully ,plan your death so you can die peacefully" explain the text​

Answers

Pretty sure that just means to make the most of your life, and to have a good ending to it

unused tunnel and give reasons for people to use it is it safe​

Answers

Answer:

According to that blurb, tunnels are “some of the safest places to be during an earthquake.” Jean-Philippe Avouac, geology professor at Caltech, more or less agrees. “Structures which are underground are less vulnerable to shaking than structures at the surface,” he says. “That's just the effect of inertia."

Explanation:

What two players struck out in the poem Casey the bat

Answers

Answer:

Casey at the Bat: A Ballad of the Republic Sung in 1888' is the full title of an American poem written by Ernest Lawrence Thayer. The poem tells the story of the final half-inning of a baseball game. The home team of Mudville is losing four to two. The first two batters for Mudville quickly strike out, but the following two get on base safely so that a home run will win the game for Mudville. The next batter is the team's star hitter Mighty Casey, whom the crowd believes will pull through.

In the poem, Mighty Casey gets two pitches right down the middle of the plate, but he passes them up, waiting for an even better pitch to hit. The crowd is in a frenzy because one more strike means that Casey is out and the game is over.

Mighty Casey sneers at the pitcher with determination, and the pitcher makes the third pitch. Casey swings incredibly hard, and the author notes that in other places in the country, people are happy and smiling -- but not in the ballpark because Casey has struck out to lose the game for Mudville.

From Charlie's report, what do you think he is supposed to do on the Rorschach test?

Answers

Answer:

I would need to see Charlie's report

Answer:

;v

Explanation:

Read the stanza from “Eldorado.” And, as his strength Failed him at length, He met a pilgrim shadow– “Shadow,” said he, “Where can it be– This land of Eldorado?” What rhyme scheme does this stanza use?
ABCABC

AACBBC

AABCCB

AABCCD

Answers

Answer:

AABCCD

Explanation:

Edgar Allen Poe's poem "Eldorado" talks of a knight who journeys through "sunshine ... and shadow", looking for the lost paradise city of Eldorado. The poem is a similar theme of looking for the lost city and how it has caught the interest of many explorers.

The rhymes scheme of a poem refers to the way the words are used in each line of a poem. In the given lines taken from the third stanza of the poem, the rhyme scheme is AABCCD.

Considering the lines of the poem,

And, as his strength (A)

Failed him at length, (A)

He met a pilgrim shadow— (B)

‘Shadow,’ said he, (C)

‘Where can it be— (C)

This land of Eldorado?’ (D)

the end word in the first line is "strength", with the same rhyme as "length". So, if we put "A" as the symbol for the first rhyming words, then "shadow" can be put as "B" and "he" and "be" of the third and fourth lines can be written as C. Likewise, "Eldorado" is put as "D".

Thus, the sequence comes as AABCCD.

Explain what Pirsig meant with his river metaphor in paragraph 16.

Answers

Hello. You did not enter the text to which this question is related, which makes it impossible for it to be answered accurately. However, I will try to help you in the best possible way.

It is only possible to analyze and describe the meaning of the metaphor by reading the text. However, I can inform you that a metaphor is a figure of speech that presents the comparison between two elements that have a certain relationship. This comparison causes one element to transfer its meaning to the other element. An example of this is the phrase "that boy is a monster" where the terms "boy" and "monster" are compared, but the term "monster" transfers its meaning to the term "boy", conveying the meaning that the boy is unpleasant, violent and frightening. To answer your question, you need to identify the metaphor and be able to make that kind of association between the two terms compared.

The excerpt serves as which type of support for the authors’ argument? a claim a counterclaim evidence an umbrella statement

Answers

Answer:

Evidence

Explanation:

The excerpt which serves as a ___________ type of support for the authors’ argument is:

Evidence

According to the given question, we are asked to show the type of support which the excerpt serves for the author's argument.

As a result of this, we can see that form the complete text, there is the narration about a particular claim and the author makes use of evidence to support his argument and make it valid

Therefore, the correct answer is option C

Read more about argument here:

https://brainly.com/question/19680017

Do you think online shopping will cause lots of smaller shops to close down?​

Answers

Answer:

no

Explanation:

unless they have an online website aswell, yes

25 POINTS!! Which of the following is NOT an example of a symbol we see in our culture?

poodles
stop sign
a cross
an apple with a bite taken out of it

Answers

Answer:A.)Poodles
Explanation:weird answers

Answer:

I would think poodles. Apple makes the iPhone, a stop sign...well, and a cross is a symbol for God.

Explanation:

Which reconstruction amendment overturned the ruling in the Dred Scott Decision?

Answers

Answer:

After the Civil War, the 13th Amendment and 14th Amendment effectively overturned the Dred Scott decision.

I have down syndrome and a abusive parents they won’t help Please help. (Ignore my show).

Answers

Answer:

Department of Children and Families

Abuse Hotline 1-800-962-2873

Explanation:

Hope your doing okay, just hang on. They will help you.

Other Questions
find the quotient 12/156/11 Which sentence is correctly punctuated?OA"I can't believe I got a job at Yvonne's Hair Salon!" shouted Charlese..."Are you sure I don't have to take the exit exam"? asked Sylvester.OC.The teacher looked around and said, "The test will cover chapter five".OD. "Dr. Rivers is the toughest teacher on campus" Paul exclaimed in dismay! Describe the translation below using words and then write a rule for it. What is a dangling modifier? A. A description of the verbB. A description of the subject nounC. A description with no clear objectD .A description of the sentence Patterson Development sometimes sells property on an installment basis. In those cases, Patterson reports income in its income statement in the year of the sale but reports installment income by the installment method on the tax return. Installment income in 2021 was $240 million, which Patterson expects to collect equally over the next four years. The tax rate is 25%, but based on an enacted law, is scheduled to become 35% in 2023. Patterson's pretax accounting income for the 2013 income statement was $530 million of this, $30 million is non-taxable revenue from proceeds of a life insurance policy. There were no differences between accounting income and taxable income other than those described above and no cumlative temporary differences existed at the beggining of the year:1. Prepare the appropriate journal entry to record patterson's 2013 income taxes. 2. What is Patterson's 2013 net income? Describe how globalization has changed Dubai. Use visual clues from the image above as well as your own knowledge to support your answer. Oxalic Acid, a compound found in plants and vegetables such as rhubarb, has a mass percent composition of 26.7% C, 2.24% H, and 71.1% O. Oxalic acid can interfere with respiration and cause kidney or bladder stones. If a large quantity of rhubarb leaves is ingested, the oxalic acid can be toxic. The lethal dose (LD50) in rats for oxalic acid is 375 mg/kg. Rhubarb leaves contain about 0.5% by mass of oxalic acid. (Show your work, using the insert equation tool :) What is the empirical formula of oxalic acid PLEASEPLEASE ANSWER and if i get any more bots answering with links im gonna cry ive put this question 5 times Study the image, and then choose the statement that best describes the image. OohBalloons are deflatin'Guess they look lifeless like meWe miss you on your side of the bed, mmmStill got your things hereAnd they stare at me like souvenirsDon't wanna let you out my headJust like the day that I met youThe day I thought foreverSaid that you love me But that'll last for neverIt's cold outsideLike when you walked out my lifeWhy you walked out my life?I get like this every timeOn these days that feel like you and meHeartbreak anniversary'Cause I remember every timeOn these days that feel like you and meHeartbreak anniversaryDo you ever think of me? If the driver slammed on the brakes, what could happen to the crate? If aluminum nitrate reacts with calcium phosphite, what is the balanced coefficient of aluminum nitrate? how do child laborers compare to child slaves from chocotate from children Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help